Mar 30, 2025 · RAB10 (RAB10, Member RAS Oncogene Family) is a Protein Coding gene. Diseases associated with RAB10 include Spastic Paraplegia 3, Autosomal Dominant and Carpenter Syndrome 1 . Among its related pathways are Innate Immune System and Vesicle-mediated transport .

Dec 23, 2012 · We have identified Rab10 as an ER-specific Rab GTPase that regulates ER structure and dynamics. We show that Rab10 localizes to the ER and to dynamic ER-associated structures that track...

Here, we review the possible genetic, molecular, and functional role of RAB10 in AD and potential therapeutic approaches to target RAB10. Keywords: Alzheimer’s disease, RAB10, retromer, APP, resilience, GTPase.

Ras-related protein Rab-10 is a protein that in humans is encoded by the RAB10 gene. [5] [6]

Rab10 has been implicated in a myriad of activities ranging from polarized exocytosis and endosomal sorting in polarized cells, insulin-dependent Glut4 transport in adipocytes, axonal growth in neurons, and endo-phagocytic processes in macrophages.

Rab10, a small Rab GTPase involved in vesicular trafficking, has recently been identified as a novel protein associated with AD. Interestingly, Rab10 is a key substrate of leucine-rich repeat kinase 2 (LRRK2), a serine/threonine protein kinase genetically associated with the second most common neurodegenerative disease Parkinson's disease.

RAB10 is a protein coding gene with GTP and GDP binding domains and belongs to the RAS superfamily of small GTPases [15 – 17]. It can regulate intracellular vesicle trafficking.

Mar 10, 2023 · Our data demonstrate that Rab10 defines a novel membrane compartment that is rapidly mobilised towards the axon terminal upon BDNF stimulation, enabling the axon to fine-tune retrograde signalling depending on BDNF availability at the synapse.

5 days ago · Rab10-EGFP construct was obtained from a mouse cDNA library by PCR and labeled with EGFP at the C-terminus. The target sequences of shRNA are as follows: CGATGCCTTCAATACCACCTT (shRNA#9), GAGAGTTGTACCGAAAGGCAA (shRNA#11), TTC TCCGAACGTGTCACGT (control, scramble), CGATGCATTTAACACAACCTT (Rab10 …

Dec 28, 2018 · Here, we review the possible genetic, molecular, and functional role of RAB10 in AD and potential therapeutic approaches to target RAB10. Keywords: APP; Alzheimer’s disease; GTPase; RAB10; resilience; retromer. Alzheimer's disease (AD) is mainly a late-onset neurodegenerative disorder.