pSL0527 (pDonor) - Addgene
Plasmid pSL0527 (pDonor) from Dr. Samuel H. Sternberg's lab contains the insert VchCAST donor DNA (Mini-Tn) and is published in Nature. 2019 Jul;571 (7764):219-225. doi: …
pDONR221 Sequence and Map - SnapGene
Gateway® donor vector with attP1 and attP2 sites and a kanamycin resistance marker. Sequence Author: Thermo Fisher (Invitrogen) Explore Over 2.7k Plasmids: Gateway® Cloning Vectors | …
pDONRTM vectors are Gateway®-adapted vectors designed to generate attL-flanked entry clones containing your gene of interest following recombination with an attB expression clone …
pDonorCm(Ptr) - Addgene
Plasmid pDonorCm (Ptr) from Dr. Sheng Yang's lab contains the insert Mini-Tn, Cm cassette and is published in Nucleic Acids Res. 2021 Sep 3. pii: 6363765. doi: 10.1093/nar/gkab752. This …
Gateway™ pDONR™221 Vector - Thermo Fisher Scientific
The pDONR™221 vector has a pUC origin for high plasmid yields and universal M13 sequencing sites for ease of use. For Research Use Only. Not for use in diagnostic procedures. Gateway …
pDonor-tBFP-NLS-Neo (Universal) - Addgene
Plasmid pDonor-tBFP-NLS-Neo (Universal) from Dr. Kazuhisa Nakayama's lab contains the insert PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT) and is published in Mol …
pDONR P4-P1r Sequence and Map - SnapGene
Gateway® donor vector with attP4 and attP1 (reversed) sites and a kanamycin resistance marker. Sequence Author: Thermo Fisher (Invitrogen) Explore Over 2.7k Plasmids: Gateway® Cloning …
pDONR vectors are Gateway®-adapted vectors designed to generate attL-flanked entry clones containing your gene of interest following recombination with an attB expression clone or an …
pDONR221 vector map and sequence - novoprolabs.com
pDONR221 is a cloning vector, with attP1 and attP2 sites and a kanamycin resistance marker. Kropp KN, Schäufele TJ, Fatho M, Volkmar M, Conradi R, Theobald M, Wölfel T, Wölfel C. A …
pDONR201 Sequence and Map - SnapGene
Donor vector for inserting an attB-flanked gene to generate an attL-containing entry vector in the Gateway® system. Sequence Author: Thermo Fisher (Invitrogen) Explore Over 2.7k Plasmids: …