It has a TEV-cleavable His6 fusion tag on its N-terminus. MBP can enhance your protein's solubility and expression. It can also be used as an affinity tag. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and ...

Plasmid 6-His-MBP-TEV-FnCpf1 from Dr. Feng Zhang's lab contains the insert FnCpf1 (humanized) and is published in Cell. 2015 Sep 23. pii: S0092-8674 (15)01200-3. doi: 10.1016/j.cell.2015.09.038. This plasmid is available through Addgene.

Plasmid pET28-MBP-TEV from Dr. Thomas Wassmer's lab is published in Cell Mol Life Sci. 2015 Jul 28. This plasmid is available through Addgene.

Expression and Purification of His-tagged TEV Protease The expression vector, pETTev, produces an MBP-His-TEV protease fusion with an internal cleavage site. The product self cleaves intracellularly to yield His-tagged protease.

This chapter describes a simple method for overproducing a soluble form of the tobacco etch virus (TEV) protease in Escherichia coli and purifying it to homogeneity so that it may be used as a reagent for removing affinity tags from recombinant proteins by site-specific endoproteolysis.

The fusion protein cleaves itself in vivo to remove the MBP moiety, yielding a soluble TEV protease catalytic domain with an N-terminal polyhistidine tag. The His7-tagged TEV protease can be purified in two steps using immobilized metal affinity chromatography (IMAC) followed by …

pDB.His.MBP Bacterial expression vector with a kanamycin resistance marker, for appending an N-terminal 6xHis-MBP tag followed by a TEV site. Sequence Author : Berkeley Structural Genomics Center

Mar 8, 2007 · We describe a generic protocol for the overproduction and purification of recombinant proteins in Escherichia coli. The strategy utilizes a dual His 6 -maltose binding protein (HisMBP) affinity...

General Plasmid Transform Protocol. 1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min. 2.

In an effort to further ameliorate the TEVP intracellular processing system, we found out that an MBP-TEVP-rsTEV-GFP-His 6 fusion protein is able to carry out near 100% site-specific autonomous cleavage in vivo, and generates MBP-TEVP and …